View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_255 (Length: 223)
Name: NF11171A_low_255
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_255 |
 |  |
|
| [»] scaffold0057 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 23 - 210
Target Start/End: Original strand, 46844530 - 46844717
Alignment:
| Q |
23 |
ccgtgtctgtcttattacatcaaaggaaagtatgatttgctaatttgtgtccgattagaattagaacgattccttgaaggaatgatagtgaataccatga |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46844530 |
ccgtgtctgtcttattacatcaaaggaaagtataatttgctaatttgtgtccgattagaattagaccgattccttgaaggaatgatagtgaataccatga |
46844629 |
T |
 |
| Q |
123 |
gatcttgaacctagttgcattattgcattgcaggggtgagatggcattttgcagccatgaatgccgtgaccagaggatattgttggag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
46844630 |
gatcttgaacctagttgcattattgcattgcaggggtgagatggcattttgcagccatgaatgccgtgaccagaggatgttgttggag |
46844717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 48986 - 48931
Alignment:
| Q |
155 |
ggggtgagatggcattttgcagccatgaatgccgtgaccagaggatattgttggag |
210 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||||| | |||||||| |
|
|
| T |
48986 |
ggggtgagatggcattttgcaaccctgaatgccgtaaccagaggaaactgttggag |
48931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 153 - 210
Target Start/End: Complemental strand, 28099 - 28042
Alignment:
| Q |
153 |
caggggtgagatggcattttgcagccatgaatgccgtgaccagaggatattgttggag |
210 |
Q |
| |
|
|||| |||||||||||||||||| || |||||| ||| ||||||||| | |||||||| |
|
|
| T |
28099 |
caggcgtgagatggcattttgcaaccttgaatgtcgtaaccagaggaaactgttggag |
28042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University