View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_257 (Length: 222)
Name: NF11171A_low_257
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_257 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 9 - 222
Target Start/End: Complemental strand, 379457 - 379244
Alignment:
| Q |
9 |
gctggtggggttcaagctcattcaactaaggtggtccagatcaggggcagatcttcttaggagtccatggtagccatggctccccctaaatatggtatta |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
379457 |
gctggtggggttcaagctcattcaactaaggtggtccagatcaggggcaaatcttcttaggagtccatggtaaccatggctccccccaaatatggtatta |
379358 |
T |
|
| Q |
109 |
atattgtatcaatcatacttaatcaggcttttcatatgtgtcgcaatggaaactaaaagctctatgtatcaagtggtcgtgagttcgaacgaaatgaaac |
208 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
379357 |
atattgtatcatgcatacttaatgaggcttttcatatgtgtcgcaatggaaactaaaagcgctatgtatcaagtggtcgtgagttcgaacggaatgaacc |
379258 |
T |
|
| Q |
209 |
accacaacacatta |
222 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
379257 |
accacaacacatta |
379244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 50 - 96
Target Start/End: Complemental strand, 10574361 - 10574315
Alignment:
| Q |
50 |
caggggcagatcttcttaggagtccatggtagccatggctcccccta |
96 |
Q |
| |
|
||||||| ||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
10574361 |
caggggcggatcttcttgggagcccatggtagccatggctcccccta |
10574315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 56 - 113
Target Start/End: Complemental strand, 42148821 - 42148764
Alignment:
| Q |
56 |
cagatcttcttaggagtccatggtagccatggctccccctaaatatggtattaatatt |
113 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||| |||| | ||||| ||||| |
|
|
| T |
42148821 |
cagatcttcttaagagcccatggtagccatggctccccccaaatttcgtatttatatt |
42148764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University