View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_259 (Length: 221)
Name: NF11171A_low_259
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_259 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 22 - 202
Target Start/End: Complemental strand, 37676810 - 37676630
Alignment:
| Q |
22 |
gaagaaggagaacgaacattgaagtgaagaaatgcatcgttataagcctgacgatgtaagtgctcagattccaagatgacaccgtcacagtcaaatataa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37676810 |
gaagaaggagaacgaacattgaagtgaagaaatgcatcgttataagcctgacgatgtaagtgctcagattccaagatgacaccgtcacagtcaaatataa |
37676711 |
T |
 |
| Q |
122 |
gagcttgaaacgaagatgaagatgaagctgagactttaaagaagacacggtggttattacggttattgttgctgaaagaag |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37676710 |
gagcttgaaacgaagatgaagatgaagctgagactttaaagaagacacggtggttattacggttattgttgctgaaagaag |
37676630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University