View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_265 (Length: 219)
Name: NF11171A_low_265
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_265 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 40605902 - 40606119
Alignment:
| Q |
1 |
tacatgataatattaccatattttgaaagaacaaatgaattcttgaggttctgtgcatttaaactccctcacaagtcacaacaaccaagtgcagttgtat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40605902 |
tacatgataatattaccatattttgaaagaacaaatgaattcttgaggttctgtgcatttaaactccctcacaagtcccaacaaccaagtgcagttgtat |
40606001 |
T |
|
| Q |
101 |
atattattattggaaccaatattcgccaacaaatctggggcatatactccctacggcctattgcaacttgcaagctattctattctaactcagctgcaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40606002 |
atattattattggaaccaatattcgccaacaaatctggggca-atactccctacggcctattgcaacttgcaagctattctattctaactcagctgcaca |
40606100 |
T |
|
| Q |
201 |
accaggccctgtatatgta |
219 |
Q |
| |
|
|||||||||||||| |||| |
|
|
| T |
40606101 |
accaggccctgtatttgta |
40606119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University