View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_271 (Length: 215)
Name: NF11171A_low_271
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_271 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 25 - 196
Target Start/End: Complemental strand, 28587092 - 28586921
Alignment:
| Q |
25 |
atctatacttgggaacatatggtaaacgtttaccttttcttgttaacctttctattttataaaatatgattggatttagtgaaatgatagtatgagtgta |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28587092 |
atctatacttgggaacatatggtaaacgtttacctattcttgttaacttttctattttataaaatatgattggatttagtgaaatgatagtatgagtgta |
28586993 |
T |
 |
| Q |
125 |
tgacaccattagctttaatctactcatatattttaccaatctccccatatattctgtatccatatatattac |
196 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28586992 |
tgacaccattaactttaatctactgatatattttaccaatctccccatatattctgtatccatatatattac |
28586921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University