View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_275 (Length: 213)
Name: NF11171A_low_275
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_275 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 8e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 75 - 196
Target Start/End: Complemental strand, 37969018 - 37968894
Alignment:
| Q |
75 |
ccgttgttttgtggggcct---gtagctgcccttccatggacaatagtagaattggctacgtgcacgtgtagtttgaacgacgcggcttcaacttcaacg |
171 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37969018 |
ccgttgttttgtggggcctcctgtagctgcccttccatggacaatagtagaattggctacgtgcacgtgtagtttgaacgacgcggcttcaacttcaacg |
37968919 |
T |
|
| Q |
172 |
aatgcatggatgaaaataggggtta |
196 |
Q |
| |
|
|||||||||||| |||||||||||| |
|
|
| T |
37968918 |
aatgcatggatggaaataggggtta |
37968894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 139 - 196
Target Start/End: Complemental strand, 6357380 - 6357323
Alignment:
| Q |
139 |
tgtagtttgaacgacgcggcttcaacttcaacgaatgcatggatgaaaataggggtta |
196 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6357380 |
tgtagtttgaacaacggagcttcaacttcaacgaatgcatggatggaaataggggtta |
6357323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University