View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_284 (Length: 207)
Name: NF11171A_low_284
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_284 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 4e-71; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 19 - 179
Target Start/End: Complemental strand, 33399989 - 33399827
Alignment:
| Q |
19 |
tgaagagattcatttctat--tcttcaagaatttatgtgaagactacaacgaaaagaagccactcttgttagctccccgcatgagaaatgtcattcgggt |
116 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399989 |
tgaaaagattcatttctatgatcttcaagaatttatgtgaagactacaacgaaaagaagccacatttgttagctccccgcatgagaaatgtcattcgggt |
33399890 |
T |
|
| Q |
117 |
gactagaggaaataggaatttggacaatttatagcacctcaaaaggaaggaatcagctgtcct |
179 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399889 |
gactagaggaaataggaatttggacaagttatagcacctcaaaaggaaggaatcagctgtcct |
33399827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 136 - 204
Target Start/End: Original strand, 32492827 - 32492895
Alignment:
| Q |
136 |
ttggacaatttatagcacctcaaaaggaaggaatcagctgtcctaagggaagggggagcattgtgtcca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
32492827 |
ttggacaatttatagcacctcaaaaggaaggaatcagctgtcctaagggaagggggggcattgcgtcca |
32492895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 19 - 86
Target Start/End: Original strand, 32492759 - 32492828
Alignment:
| Q |
19 |
tgaagagattcatttctattcttcaagaatt--tatgtgaagactacaacgaaaagaagccactcttgtt |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32492759 |
tgaagagattcatttctattcttcaagaatttatatgtgaagactgcaacgaaaagaagccactcttgtt |
32492828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University