View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_291 (Length: 204)
Name: NF11171A_low_291
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_291 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 58 - 187
Target Start/End: Original strand, 40777385 - 40777508
Alignment:
| Q |
58 |
gatgaattaagttgagaaaataaagaatgtgccacaatcatggcattgctcactcacaaccttactattactaatagaaatgtctatttcatttcaaatt |
157 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40777385 |
gatgaattaagttgagaaaataaataatgtgccataatcatggcattgctcactcacaaccttac------taatagaaatgtctatttcatttcaaatt |
40777478 |
T |
|
| Q |
158 |
tagaaaataagaatcttacaatgcatatta |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
40777479 |
tagaaaataagaatcttacaatgcatatta |
40777508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University