View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_63 (Length: 350)
Name: NF11171A_low_63
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_63 |
 | |
|
| [»] scaffold0421 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 149 - 248
Target Start/End: Original strand, 42211920 - 42212019
Alignment:
| Q |
149 |
actttttgtgacgtgcactttctctgtccttttctacggttttcattttctctcaaatctaaacccttcttctcacactttttgcaactgtcacgtgtgg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42211920 |
actttttgtgacgtgcactttctctgtccttttctacggttttcattttctctcaaatctaaacccttcttctcacactttttgcaactgtcacgtgtgg |
42212019 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0421 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0421
Description:
Target: scaffold0421; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 86 - 146
Target Start/End: Complemental strand, 13330 - 13270
Alignment:
| Q |
86 |
ccatgccgtgtcattggtggtagaaaagggtgtaccaaaagagtggtacatgaatcttttt |
146 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13330 |
ccatgccatgtcatcggtggtagaaaagggtgtaccaaaagagtggtacatgaatcttttt |
13270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University