View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_65 (Length: 340)
Name: NF11171A_low_65
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_65 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 288; Significance: 1e-161; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 288; E-Value: 1e-161
Query Start/End: Original strand, 7 - 334
Target Start/End: Original strand, 21642420 - 21642747
Alignment:
| Q |
7 |
actctttactttaaattaaaccccggcccccatttatctcacgcccgtcatctcttcgactcacttcacgtcaaagatgttatctcatggacttcactta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
21642420 |
actctttactttaaattaaaccccggcccccatttatctcacgcccgtcatctcttcgactcacttcacgtcaaagatgtcatctcatggacttcactta |
21642519 |
T |
 |
| Q |
107 |
tctccggttacactcgctccggccagccacatcagtcgatatctttattctacgaaatgttggcatttcctattcaacccaatgcttttactctatcttc |
206 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21642520 |
tctccggttacactcgctccgacctgccacatcaatcgatatctttattctacgaaatgttggcatttcctgttcaacccaatgcttttactctatcttc |
21642619 |
T |
 |
| Q |
207 |
cgttattaaagcttgttctacgttgaatgacgtaaaccttgggagatgttttcattctatggttttaacacgtgggtttgattggaatactgttgtttcg |
306 |
Q |
| |
|
||||| |||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21642620 |
tgttatcaaagcttgttctgcgttaaatgacgtaaaccttgggagatgctttcattctatggttttaacacgtgggtttgattggaatactgttgtttcg |
21642719 |
T |
 |
| Q |
307 |
tgttcgttgattgatatgtatggttgga |
334 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
21642720 |
tgttcgttgattgatatgtatggttgga |
21642747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University