View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_77 (Length: 322)
Name: NF11171A_low_77
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_77 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 302; Significance: 1e-170; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 5 - 322
Target Start/End: Complemental strand, 36170710 - 36170393
Alignment:
| Q |
5 |
tgtcgaagaaaatatagcaactgatccacaaaaccataactcattaaaatacttacagagctagatgaagtaaaacacaaactttcaatagccctcattg |
104 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170710 |
tgtcgaacataatatagcaactgatccacaaaaccataactcattaaaatacttacagagctagatgaagtaaaacacaaactttcaatagccctcattg |
36170611 |
T |
 |
| Q |
105 |
ttatttcctttgtttttgaagaatatgaccatttcggatctaaaacacgtaacaaagcacggattccgccttctctaatcaccgtttgcctaaccaactc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36170610 |
ttatttcctttgtttttgaagaatatgaccatttcggatctaaaacacgtaacaaagcacggattccgccttctctaatcaccatttgcctaaccaactc |
36170511 |
T |
 |
| Q |
205 |
atctccaaaggcaatattctgaatgaaccctattgaattcacctgaattgcttcctcctttgatttcactagcctgataaaagtcgacaccgcatcctcc |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170510 |
atctccaaaggcaatattctgaatgaaccctattgaattcacctgaattgcttcctcctttgatttcactagcctgataaaagtcgacaccgcatcctcc |
36170411 |
T |
 |
| Q |
305 |
tcaaccataaatctctta |
322 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
36170410 |
tcaaccatgaatctctta |
36170393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 5 - 67
Target Start/End: Original strand, 1286332 - 1286394
Alignment:
| Q |
5 |
tgtcgaagaaaatatagcaactgatccacaaaaccataactcattaaaatacttacagagcta |
67 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1286332 |
tgtcgaacataatatagcaactgatccacaaaaccataactcattaaaatacttacagagcta |
1286394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University