View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171A_low_96 (Length: 293)
Name: NF11171A_low_96
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171A_low_96 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 6408328 - 6408388
Alignment:
| Q |
18 |
ttgatgattagtaatgaatttgtgtttaattttgtgcattcttctatgttttggttttcat |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||| | |||||||| |
|
|
| T |
6408328 |
ttgatgattagtaatgaatttgtgtttaattctgtgcattcttctatgttctagttttcat |
6408388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000007; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 38 - 78
Target Start/End: Complemental strand, 4966547 - 4966507
Alignment:
| Q |
38 |
tgtgtttaattttgtgcattcttctatgttttggttttcat |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4966547 |
tgtgtttaattttgtgcattcttctatgttttagttttcat |
4966507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 60
Target Start/End: Complemental strand, 9818507 - 9818465
Alignment:
| Q |
18 |
ttgatgattagtaatgaatttgtgtttaattttgtgcattctt |
60 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
9818507 |
ttgatgattagtaatgaatatgtgtttaattttgtgcgttctt |
9818465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 9824225 - 9824171
Alignment:
| Q |
18 |
ttgatgattagtaatgaatttgtgtttaattttgtgcattcttctatgttttggttt |
74 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||| ||||||| |||| |
|
|
| T |
9824225 |
ttgatgattagtaatgaatatgt--ttaattttgtgcattctttgatgttttagttt |
9824171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University