View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11171A_low_96 (Length: 293)

Name: NF11171A_low_96
Description: NF11171A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11171A_low_96
NF11171A_low_96
[»] chr5 (1 HSPs)
chr5 (18-78)||(6408328-6408388)
[»] chr6 (3 HSPs)
chr6 (38-78)||(4966507-4966547)
chr6 (18-60)||(9818465-9818507)
chr6 (18-74)||(9824171-9824225)


Alignment Details
Target: chr5 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 18 - 78
Target Start/End: Original strand, 6408328 - 6408388
Alignment:
18 ttgatgattagtaatgaatttgtgtttaattttgtgcattcttctatgttttggttttcat 78  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||| | ||||||||    
6408328 ttgatgattagtaatgaatttgtgtttaattctgtgcattcttctatgttctagttttcat 6408388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.000000000007; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 38 - 78
Target Start/End: Complemental strand, 4966547 - 4966507
Alignment:
38 tgtgtttaattttgtgcattcttctatgttttggttttcat 78  Q
    |||||||||||||||||||||||||||||||| ||||||||    
4966547 tgtgtttaattttgtgcattcttctatgttttagttttcat 4966507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 60
Target Start/End: Complemental strand, 9818507 - 9818465
Alignment:
18 ttgatgattagtaatgaatttgtgtttaattttgtgcattctt 60  Q
    ||||||||||||||||||| ||||||||||||||||| |||||    
9818507 ttgatgattagtaatgaatatgtgtttaattttgtgcgttctt 9818465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 74
Target Start/End: Complemental strand, 9824225 - 9824171
Alignment:
18 ttgatgattagtaatgaatttgtgtttaattttgtgcattcttctatgttttggttt 74  Q
    ||||||||||||||||||| |||  ||||||||||||||||||  ||||||| ||||    
9824225 ttgatgattagtaatgaatatgt--ttaattttgtgcattctttgatgttttagttt 9824171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University