View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171_high_20 (Length: 264)
Name: NF11171_high_20
Description: NF11171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171_high_20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 130 - 264
Target Start/End: Original strand, 56487503 - 56487637
Alignment:
| Q |
130 |
gaatatactagtactagtaaatcgcatagcagtgagaggaactgaaaccctaaatcactccgccgctcaaactaactgcctctgtaagtgaaatctcttg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
56487503 |
gaatatactagtactagtaaatcgcatagcagtgagaggaactgaaaccctaaatcactccgccgctcaaactaactgcctctgtaagtaaaatctcttg |
56487602 |
T |
 |
| Q |
230 |
gcagatttggtttcttttcagttttcattatcgtt |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
56487603 |
gcagatttggtttcttttcagttttcattatcgtt |
56487637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University