View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171_low_22 (Length: 253)
Name: NF11171_low_22
Description: NF11171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 2e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 21 - 243
Target Start/End: Original strand, 5355540 - 5355762
Alignment:
| Q |
21 |
ataaaacaactagttataggtaaaagcacatgtgatttgaatcatattcacataaacagaaaatcagaatgacaaaacatttgtcatgattggaatcact |
120 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| | |||||||||| | ||||||| |
|
|
| T |
5355540 |
ataaaaccactagttataggtaaaagcacatgtgattcgaatcatattcacataaacagaaaaccagaatgacaaaaaaattgtcatgatcgaaatcact |
5355639 |
T |
|
| Q |
121 |
ctcggttttaattcgaatcacaaccaccataaactccaaattattgattttaaggcacaatcatttacacgcacgtttacatttgaacatcagcattata |
220 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
5355640 |
ctcggttttgattcaaatcacaaccaccataaactccaaattgttgattttaaggcacaatcatttacacatacgtttacatttggacatcagcattata |
5355739 |
T |
|
| Q |
221 |
tattcgaatgcgtgggtattctt |
243 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
5355740 |
tattcggatgcgtgggtattctt |
5355762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University