View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171_low_26 (Length: 244)
Name: NF11171_low_26
Description: NF11171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 9966489 - 9966264
Alignment:
| Q |
1 |
ctaactcagtatatttgtagtttgaaaaagctatgaatcaatgaattcttttcaccaggcaaatcatatttgactgacagaaccattcaaattcatgaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
9966489 |
ctaactcagtatatttgtagtttgaaaaagctatgaatcaatgaattcttttcaccaggcaaatcataattgactgacaaaaccattcaaattcatgaaa |
9966390 |
T |
 |
| Q |
101 |
tattgcagatgtcactattcgtgcttaaatattgttgaaactgcctgaggaacagcattcatgctaatcatcttgctcagtctgcggggtcattgtagtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9966389 |
tattgcagatgtcactattcgtgcttaaatattgttgaaactgcctgaggaacagcattcatgctaatcatcttgctcagtctgcgggttcattgtagtc |
9966290 |
T |
 |
| Q |
201 |
agttttgaggtttcagaggcaccttc |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
9966289 |
agttttgaggtttcagaggcaccttc |
9966264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University