View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11171_low_27 (Length: 242)
Name: NF11171_low_27
Description: NF11171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11171_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 15 - 153
Target Start/End: Original strand, 24244654 - 24244792
Alignment:
| Q |
15 |
atgtttttctttactttatcaactgtgacaataaattaataaaccttggaattttatgtttattgtatgtacatttcttcaatttgaattttgaggtatt |
114 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24244654 |
atgtttttctttactttaccaactgtgacaataaattaataaaccttggaattttatgtttattgtatgtacatttcttcaatttgaatttggaggtatt |
24244753 |
T |
|
| Q |
115 |
caagtttgtgcttaacctacctgtattgacttaaatgtc |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24244754 |
caagtttgtgcttaacctacctgtattgacttaaatgtc |
24244792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University