View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11172_low_17 (Length: 240)
Name: NF11172_low_17
Description: NF11172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11172_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 38)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 17 - 217
Target Start/End: Complemental strand, 27419117 - 27418917
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttcttacaactcacttctcgcttaagtgatttgtaaatcatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27419117 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttcttacaactcacttctcgcttaagtgatttgtaaatcatg |
27419018 |
T |
 |
| Q |
117 |
ctaatggagattaagatagannnnnnnnnnnnnnggatacagattgagatagattagttgaggctaatttgctcagatgacaattttttctgttattaat |
216 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27419017 |
ctaatggagattaagatagatttttattttttttggatacagattaagatagattagttgaggctaatttgctcagatgacaattttttctgttattaat |
27418918 |
T |
 |
| Q |
217 |
a |
217 |
Q |
| |
|
| |
|
|
| T |
27418917 |
a |
27418917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 21 - 92
Target Start/End: Complemental strand, 27559282 - 27559211
Alignment:
| Q |
21 |
tttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttcttacaactcacttct |
92 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27559282 |
tttggatatgatcatccaatgggtggtctcacaattccttgcagtgaagatgctttcttacaactcacttct |
27559211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 17 - 93
Target Start/End: Original strand, 27567349 - 27567425
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttcttacaactcacttctc |
93 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||| | ||||||||||||||| |||||||||||| |
|
|
| T |
27567349 |
agaatttggttatgatcatccaatgggtggtctcacaattccttgcagcgaagatgctttcttagaactcacttctc |
27567425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 17 - 94
Target Start/End: Complemental strand, 27556425 - 27556348
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttcttacaactcacttctcg |
94 |
Q |
| |
|
||||||||||||||||||| | ||||||||||| |||||||| ||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
27556425 |
agaatttggatatgatcattctatgggtggtctcacaattccatgcagtgaagatgctttcttacaactctcttctcg |
27556348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 17 - 136
Target Start/End: Original strand, 27571717 - 27571837
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttcttacaactcacttctcgctt-aagtgatttgtaaatcat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| || |||| ||| || | || ||||||||||| || ||| | || ||||| |
|
|
| T |
27571717 |
agaatttggatatgatcatccaatgggtggtctcacaattccttgcggcgaggatgaattcctaaatcttacttctcgcttgaattgagctctagatcat |
27571816 |
T |
 |
| Q |
116 |
gctaatggagattaagataga |
136 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
27571817 |
gctaatggagatttagataga |
27571837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 17 - 136
Target Start/End: Complemental strand, 27411502 - 27411383
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttcttacaactcacttctcgcttaagtgatttgtaaatcatg |
116 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||||| | || |||| ||| | | ||||| ||||| || ||||| ||||||||| | |
|
|
| T |
27411502 |
agaatttggatatgatcatcctatgggtggtctcacaattccttgcagcgaggatgaattccaaaacctcacatctcgtttgagtgaactgtaaatcaag |
27411403 |
T |
 |
| Q |
117 |
ctaatggagattaagataga |
136 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
27411402 |
ctaatggagattaagataga |
27411383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 23 - 94
Target Start/End: Complemental strand, 27421971 - 27421900
Alignment:
| Q |
23 |
tggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttcttacaactcacttctcg |
94 |
Q |
| |
|
|||||| |||||||||| ||||||||| |||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
27421971 |
tggatacgatcatccaacgggtggtctcacaattccttgcagtgaagattctttcttacaactcacttctcg |
27421900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 17 - 72
Target Start/End: Complemental strand, 27414350 - 27414295
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatg |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
27414350 |
agaatttggatatgatcatccaatgggtggtcttacaattccgtgcagtgaagatg |
27414295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 17 - 97
Target Start/End: Complemental strand, 27507859 - 27507779
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttcttacaactcacttctcgctt |
97 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| | |||||| ||||||| | ||||||||||||| |
|
|
| T |
27507859 |
agaatttggatatgaccatccaatgggtggtcttacaattccttgtgaagaagatcttttcttagatatcacttctcgctt |
27507779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 19 - 97
Target Start/End: Original strand, 27473988 - 27474066
Alignment:
| Q |
19 |
aatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttcttacaactcacttctcgctt |
97 |
Q |
| |
|
|||||| |||||||||||||||||||||||| || ||||||||||| ||||| | ||||||| | ||||||||||||| |
|
|
| T |
27473988 |
aatttgaatatgatcatccaatgggtggtctcaccattccttgcggagaagacgttttcttagacatcacttctcgctt |
27474066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 17 - 61
Target Start/End: Complemental strand, 27502853 - 27502809
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttg |
61 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
27502853 |
agaatttggatatgaccatccaatgggtggtcttactattccttg |
27502809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 21 - 73
Target Start/End: Complemental strand, 27563388 - 27563336
Alignment:
| Q |
21 |
tttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgc |
73 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
27563388 |
tttggatatgatcatccaatgggtggcctcacaattccttgcactgaagatgc |
27563336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 62
Target Start/End: Original strand, 27487079 - 27487122
Alignment:
| Q |
19 |
aatttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27487079 |
aatttgaatatgatcatccaatgggtggtcttactattccttgc |
27487122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 19 - 97
Target Start/End: Original strand, 27466917 - 27466995
Alignment:
| Q |
19 |
aatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttcttacaactcacttctcgctt |
97 |
Q |
| |
|
|||||| |||||||||||||||||||||||| || ||||||||| | ||||| | ||||||| | |||||||| |||| |
|
|
| T |
27466917 |
aatttgaatatgatcatccaatgggtggtctcactattccttgcagagaagaagttttcttagacatcacttctagctt |
27466995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 17 - 58
Target Start/End: Complemental strand, 27424560 - 27424519
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattcc |
58 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27424560 |
agaatatggatatgatcatccaatgggtggtcttaccattcc |
27424519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 27444838 - 27444777
Alignment:
| Q |
19 |
aatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttctta |
80 |
Q |
| |
|
|||| |||||||| ||||||||||||||||| |||||||||||| | ||||| | ||||||| |
|
|
| T |
27444838 |
aattcggatatgaccatccaatgggtggtctcacaattccttgcagagaagacgttttctta |
27444777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 70
Target Start/End: Original strand, 27498518 - 27498562
Alignment:
| Q |
26 |
atatgatcatccaatgggtggtcttacaattccttgcggtgaaga |
70 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||| ||||| |
|
|
| T |
27498518 |
atatgatcatccaatgggtggtctcactattccttgcggagaaga |
27498562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 62
Target Start/End: Original strand, 27460574 - 27460617
Alignment:
| Q |
19 |
aatttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
|||||| |||||||||||||||||||||||| || ||||||||| |
|
|
| T |
27460574 |
aatttgaatatgatcatccaatgggtggtctcaccattccttgc |
27460617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 62
Target Start/End: Original strand, 27476783 - 27476826
Alignment:
| Q |
19 |
aatttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
|||||| |||||||||||||||||||||||| || ||||||||| |
|
|
| T |
27476783 |
aatttgaatatgatcatccaatgggtggtctaactattccttgc |
27476826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 62
Target Start/End: Original strand, 27479997 - 27480040
Alignment:
| Q |
19 |
aatttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
|||||| |||||||||||||||||||||||| || ||||||||| |
|
|
| T |
27479997 |
aatttgaatatgatcatccaatgggtggtctcaccattccttgc |
27480040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 62
Target Start/End: Complemental strand, 27502179 - 27502136
Alignment:
| Q |
19 |
aatttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
|||||| |||||||||||||||||||||||| || ||||||||| |
|
|
| T |
27502179 |
aatttgaatatgatcatccaatgggtggtctaactattccttgc |
27502136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 17 - 72
Target Start/End: Original strand, 27506792 - 27506847
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatg |
72 |
Q |
| |
|
||||||||||||||||||||| |||||||| || || ||||||||| |||||||| |
|
|
| T |
27506792 |
agaatttggatatgatcatcccatgggtggactcaccattccttgcactgaagatg |
27506847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 97
Target Start/End: Complemental strand, 27513813 - 27513742
Alignment:
| Q |
26 |
atatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttcttacaactcacttctcgctt |
97 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||| | ||||| | |||||| | ||||||||||||| |
|
|
| T |
27513813 |
atatgatcatccaatgggtggtctcactattccttgcagagaagaagtattcttagatatcacttctcgctt |
27513742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 19 - 94
Target Start/End: Complemental strand, 27526156 - 27526081
Alignment:
| Q |
19 |
aatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttcttacaactcacttctcg |
94 |
Q |
| |
|
|||||| |||||||||||||| ||||||||| || ||||||||| | ||||| | ||||||| | |||||||||| |
|
|
| T |
27526156 |
aatttgaatatgatcatccaacgggtggtctcactattccttgcagagaagacgttttcttagagatcacttctcg |
27526081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 21 - 91
Target Start/End: Original strand, 27446245 - 27446315
Alignment:
| Q |
21 |
tttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttcttacaactcacttc |
91 |
Q |
| |
|
|||| ||||||||||| ||||| |||||| | ||||||||| ||||||||| ||||||| ||| |||||| |
|
|
| T |
27446245 |
tttgaatatgatcatcgaatggatggtctctcgattccttgcagtgaagatgttttcttagaacacacttc |
27446315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 27554405 - 27554447
Alignment:
| Q |
19 |
aatttggatatgatcatccaatgggtggtcttacaattccttg |
61 |
Q |
| |
|
||||||||||||||||||||| |||| |||| ||||||||||| |
|
|
| T |
27554405 |
aatttggatatgatcatccaacgggtagtctcacaattccttg |
27554447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 97
Target Start/End: Original strand, 27557585 - 27557663
Alignment:
| Q |
19 |
aatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttcttacaactcacttctcgctt |
97 |
Q |
| |
|
|||||| ||||| |||||||||||||||||| || ||||| ||| | ||||||| ||||||| | ||||||| ||||| |
|
|
| T |
27557585 |
aatttgaatatgttcatccaatgggtggtctcactattccatgcagagaagatgttttcttagatatcacttcgcgctt |
27557663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 62
Target Start/End: Original strand, 17970393 - 17970438
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| || |||||||||||| |
|
|
| T |
17970393 |
agaattcggatacgatcatccaatgggtggcctcacaattccttgc |
17970438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 62
Target Start/End: Original strand, 27412762 - 27412803
Alignment:
| Q |
21 |
tttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
|||||||||||||||||||||||||| || || ||||||||| |
|
|
| T |
27412762 |
tttggatatgatcatccaatgggtggcctcaccattccttgc |
27412803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 19 - 80
Target Start/End: Complemental strand, 27431192 - 27431131
Alignment:
| Q |
19 |
aatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttctta |
80 |
Q |
| |
|
||||||||||||| ||||||| |||||||| |||||||||||| | ||||| | ||||||| |
|
|
| T |
27431192 |
aatttggatatgaccatccaaccggtggtctcacaattccttgcagagaagacgttttctta |
27431131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 62
Target Start/End: Complemental strand, 27468373 - 27468328
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
||||||||||||||||||||| |||||||| || || ||||||||| |
|
|
| T |
27468373 |
agaatttggatatgatcatcccatgggtggcctcaccattccttgc |
27468328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 62
Target Start/End: Complemental strand, 27478929 - 27478884
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
||||||||||||||||||||| |||||||| || || ||||||||| |
|
|
| T |
27478929 |
agaatttggatatgatcatcccatgggtggcctcaccattccttgc |
27478884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 62
Target Start/End: Complemental strand, 27485989 - 27485944
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
||||||||||||||||||||| |||||||| || || ||||||||| |
|
|
| T |
27485989 |
agaatttggatatgatcatcccatgggtggcctcaccattccttgc |
27485944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 62
Target Start/End: Original strand, 27504020 - 27504061
Alignment:
| Q |
21 |
tttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
|||||||||||||||||||||||||| || || ||||||||| |
|
|
| T |
27504020 |
tttggatatgatcatccaatgggtggcctcaccattccttgc |
27504061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 72
Target Start/End: Complemental strand, 27565991 - 27565942
Alignment:
| Q |
23 |
tggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatg |
72 |
Q |
| |
|
|||||||||||||||||||||||| || || |||||||| || ||||||| |
|
|
| T |
27565991 |
tggatatgatcatccaatgggtggcctcaccattccttgtggcgaagatg |
27565942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 62
Target Start/End: Original strand, 27585786 - 27585827
Alignment:
| Q |
21 |
tttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
||||||||||||||||||||||| ||||| || ||||||||| |
|
|
| T |
27585786 |
tttggatatgatcatccaatgggaggtctcaccattccttgc |
27585827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 62
Target Start/End: Original strand, 27600647 - 27600692
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
||||||||| || ||||||||||||||||||| |||||||||||| |
|
|
| T |
27600647 |
agaatttggttacaatcatccaatgggtggtctcacaattccttgc |
27600692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 61
Target Start/End: Original strand, 27514985 - 27515029
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttg |
61 |
Q |
| |
|
||||||||||||||||||||| |||||||| || || |||||||| |
|
|
| T |
27514985 |
agaatttggatatgatcatcccatgggtggcctcaccattccttg |
27515029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 9)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 97
Target Start/End: Original strand, 50910054 - 50910134
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttcttacaactcacttctcgctt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||| ||||||| ||||| ||| | ||||||||||| |
|
|
| T |
50910054 |
agaatttggatatgatcatccaatgggtggcctcacaattccttgcacagaagatgtcttcttgcaaattacttctcgctt |
50910134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 17 - 79
Target Start/End: Complemental strand, 48840758 - 48840696
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttctt |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||| ||||||| |||||| |
|
|
| T |
48840758 |
agaatttggatatgatcatccaatgggtggcctcacaattccttgcacagaagatgttttctt |
48840696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 17 - 97
Target Start/End: Original strand, 55084880 - 55084960
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttcttacaactcacttctcgctt |
97 |
Q |
| |
|
|||||||||||| ||||||||||||||||| || |||||||||||| ||||||| |||||| || | ||||||||||| |
|
|
| T |
55084880 |
agaatttggatacgatcatccaatgggtggcctcacaattccttgcacagaagatgttttctttcatattacttctcgctt |
55084960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 17 - 62
Target Start/End: Original strand, 38043997 - 38044042
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
||||||||||||||||||||||||||| || || |||||||||||| |
|
|
| T |
38043997 |
agaatttggatatgatcatccaatgggcggcctcacaattccttgc |
38044042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 17 - 62
Target Start/End: Complemental strand, 50911915 - 50911870
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
|||||||||||||||||| ||||||||||| || |||||||||||| |
|
|
| T |
50911915 |
agaatttggatatgatcacccaatgggtggcctaacaattccttgc |
50911870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 97
Target Start/End: Complemental strand, 50904837 - 50904758
Alignment:
| Q |
18 |
gaatttggatatgatcatccaatgggtggtcttacaattccttgcggtgaagatgctttcttacaactcacttctcgctt |
97 |
Q |
| |
|
||||| ||||||||||||||||||||||| || || ||||||||| | ||||| | ||| || || ||||||||||||| |
|
|
| T |
50904837 |
gaattcggatatgatcatccaatgggtggcctcaccattccttgcagagaagaggtttttttgcatatcacttctcgctt |
50904758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 62
Target Start/End: Complemental strand, 38024921 - 38024876
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
|||||||||||||||||| ||||||||||| || || ||||||||| |
|
|
| T |
38024921 |
agaatttggatatgatcacccaatgggtggcctcacgattccttgc |
38024876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 62
Target Start/End: Complemental strand, 38028812 - 38028767
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
||||||||||||||| ||||||||||| || || |||||||||||| |
|
|
| T |
38028812 |
agaatttggatatgaccatccaatgggcggcctcacaattccttgc |
38028767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 62
Target Start/End: Complemental strand, 38031373 - 38031328
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
|||||||||||||||||| ||||||||||| || || ||||||||| |
|
|
| T |
38031373 |
agaatttggatatgatcacccaatgggtggcctcacgattccttgc |
38031328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 62
Target Start/End: Original strand, 3073663 - 3073708
Alignment:
| Q |
17 |
agaatttggatatgatcatccaatgggtggtcttacaattccttgc |
62 |
Q |
| |
|
|||||| ||||| ||||||||||||||||| || |||||||||||| |
|
|
| T |
3073663 |
agaattcggatacgatcatccaatgggtggcctcacaattccttgc |
3073708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University