View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11172_low_21 (Length: 206)
Name: NF11172_low_21
Description: NF11172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11172_low_21 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 194; Significance: 1e-106; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 194; E-Value: 1e-106
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 32683873 - 32684078
Alignment:
| Q |
1 |
tatttttatcaatttcaattctcggtcattgcttgctaattcttggatgaagatcaatcatcaatgtatataggaccaaaaacacatactgtgataagac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32683873 |
tatttttatcaatttcaattctcggtcattgcttgctaattcttggatgaagatcaatcatcaatgtatataggaccaaaaacacatactgtgataagac |
32683972 |
T |
 |
| Q |
101 |
taccatagattaaaacacttaggttgtttctattgtacgtagtttacaatgtgcaagtgcaaaggtcttggttgcaagttaggaacctgtgataacatga |
200 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32683973 |
taccatagattaaaacacttgggttatttctattgtacgcagtttacaatgtgcaagtgcaaaggtcttggttgcaagttaggaacctgtgataacatga |
32684072 |
T |
 |
| Q |
201 |
atgaat |
206 |
Q |
| |
|
|||||| |
|
|
| T |
32684073 |
atgaat |
32684078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University