View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11173_high_14 (Length: 249)
Name: NF11173_high_14
Description: NF11173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11173_high_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 1316612 - 1316474
Alignment:
| Q |
1 |
tttggcatataccatggaggcattcccgtgaccttgagtttatgaaaataggcttccaaatataacaactaggagtgatagagtgcccgggaggcaggga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1316612 |
tttggcatataccatggaggcattcccgtgaccttgagtttatgaaaataggcttccaaatataacaactaggagtgatagagtgcctgggaggcaggga |
1316513 |
T |
|
| Q |
101 |
gataatgctggaaaaactagttatcttggttaaatttag |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1316512 |
gataatgctggaaaaactagttatcttggttaaatttag |
1316474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 136 - 239
Target Start/End: Complemental strand, 1316434 - 1316331
Alignment:
| Q |
136 |
ttaggctctggacaatatgtttatgtaaaattacatagcttgttcgattttaatgtcaactcaaatacattaattgcttcaatagtccttttgaactcgt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1316434 |
ttaggctctggacaatatgtttatgtaaaattgcatagcttgttcgattttaatgtcaactcaaatacattaattgcttcaatagtccttttgaactcgt |
1316335 |
T |
|
| Q |
236 |
tcat |
239 |
Q |
| |
|
|||| |
|
|
| T |
1316334 |
tcat |
1316331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 43486743 - 43486621
Alignment:
| Q |
1 |
tttggcatataccatggaggcattcccgtgaccttgagtttatgaaaataggcttccaaatataacaactaggagtgatagagt--gcccgggaggcagg |
98 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || ||||||||| |
|
|
| T |
43486743 |
tttggcatataccatgaaggcattcccgtgaccttgagtttatgaaaataggcttccaaatataacaactaggagtgatagagtgggaccaggaggcagg |
43486644 |
T |
|
| Q |
99 |
gagataatgctggaaaaactagt |
121 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
43486643 |
gagataatgctggaaaaactagt |
43486621 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 136 - 222
Target Start/End: Complemental strand, 43486549 - 43486463
Alignment:
| Q |
136 |
ttaggctctggacaatatgtttatgtaaaattacatagcttgttcgattttaatgtcaactcaaatacattaattgcttcaatagtc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || | ||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43486549 |
ttaggctctggacaatatgtttatgtaaaattgcaatgtttgtttgattttaatgtcaagtcaaatacattaattgcttcaatagtc |
43486463 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University