View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11173_high_7 (Length: 338)
Name: NF11173_high_7
Description: NF11173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11173_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 17 - 325
Target Start/End: Complemental strand, 41658920 - 41658610
Alignment:
| Q |
17 |
aaagaattgtcgccgaaggaagcaaaagaagatgctcaattttgtagctgattgacacaaaatgcagtagacttcaatcaagcactttgacaaaatctaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41658920 |
aaagaattgtcgccgaaggaagcaaaagaagatgctcaattttgtagctgattgacacaaaatgcagtagacttcaatcaagcactttggcaaaatctaa |
41658821 |
T |
 |
| Q |
117 |
acttttatgaaactattaatcctttatatctattgggataaggatctatagacagttttataatattttggtagctgtgtcaagttttgatag-cgtaag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41658820 |
acttttatgaaactattaatcctttatatctattgggataaggatctatagacagttttataatattttggtagctgtgtcaagttttgatagacgtaag |
41658721 |
T |
 |
| Q |
216 |
catatatgatctttcttaatgccactataatagctagcatggtggtatatgttatgttc-tttgagattctgacttgtgtggttgtagttgctactatta |
314 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41658720 |
catatatgatcttccttaatgccgctataatagctagcatggtggtatatgttatgttcttttgagattctgacttgtgtggttgtagttgctactatta |
41658621 |
T |
 |
| Q |
315 |
tgttgtgatct |
325 |
Q |
| |
|
||||||||||| |
|
|
| T |
41658620 |
tgttgtgatct |
41658610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University