View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11173_high_9 (Length: 334)
Name: NF11173_high_9
Description: NF11173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11173_high_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 317
Target Start/End: Complemental strand, 10024864 - 10024546
Alignment:
| Q |
1 |
aacttacatgtgccatctcacacactttatgctgacaatgtgatgatattttgcaaagggaaaaagtcttgccttctgactcttaaacaacttttcattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
10024864 |
aacttacatgtgccatctcacacactttatgctgacaatgtgatgatattttgcaaagggaaaaagtcttgccttctgactcttaaac---ttttcattg |
10024768 |
T |
|
| Q |
101 |
attatgcagcctgttatggttagattattaacccttttaagccaact---------ggttccattaatgctagcagactatctcagcttgttcattttct |
191 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
10024767 |
attatgcagcctgtt----ttagattattaacccttttaagccaactttgtacactggttccattaatgctagcagactatctcagcttgttcatttgct |
10024672 |
T |
|
| Q |
192 |
acgcttaaacattggttatcttccatgcattcatatacttaggtgtccctatctttagagggagaccataagctatttaaattgtcttcttggaaagcct |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10024671 |
acgcttaaacattggttatcttccatgcattcatatacttaggtgtccctatctttagagggagaccataagctatttaaattgccttcttggaaagcct |
10024572 |
T |
|
| Q |
292 |
ctctcctttctatagccgacacaact |
317 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
10024571 |
ctctcctttctatagccgacaaaact |
10024546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University