View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11173_low_17 (Length: 234)
Name: NF11173_low_17
Description: NF11173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11173_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 41658609 - 41658392
Alignment:
| Q |
1 |
ttgatattgcacagcagtaattgatattcgatggccccaatcgcagaggccttagacctagcaatttctgctacatacctcagctctgaattatggttga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41658609 |
ttgatattgcacagcagtaattgatattccatggccccaatcgcagaggccttagacctagcaatttctgctacatacctcagctctgaattatggttga |
41658510 |
T |
|
| Q |
101 |
ctgcagtctgcagatcttaatctagaactatagttggggtgatgtggttgtctttcaatgtatgtaaaatgtgattgatatgtgatatgatatatttcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41658509 |
ctgcagtctgcagatcttaatctagaactatagttgggatgttgtggttgtctttcaatgtatgtaaaatatgattgatatgtgatatgatatatttcta |
41658410 |
T |
|
| Q |
201 |
cttctgctttgatctgtg |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
41658409 |
cttctgctttgatctgtg |
41658392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 141 - 216
Target Start/End: Complemental strand, 41657324 - 41657249
Alignment:
| Q |
141 |
gatgtggttgtctttcaatgtatgtaaaatgtgattgatatgtgatatgatatatttctacttctgctttgatctg |
216 |
Q |
| |
|
|||||||||||||||| | ||| || ||||||||| ||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
41657324 |
gatgtggttgtctttctaagtacgttaaatgtgatcgatatgtgatatgatatgtttctacttctgctgtgatctg |
41657249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 104
Target Start/End: Complemental strand, 41657411 - 41657325
Alignment:
| Q |
18 |
taattgatattcgatggccccaatcgcagaggccttagacctagcaatttctgctacatacctcagctctgaattatggttgactgc |
104 |
Q |
| |
|
|||||||||||| || ||| ||| |||||||||||||| ||||||||||||| ||| ||||| | |||| ||||||||||||| |
|
|
| T |
41657411 |
taattgatattccataaccctaattgcagaggccttagaactagcaatttctgttaccgtgctcagttttgaactatggttgactgc |
41657325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University