View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11175_high_26 (Length: 295)
Name: NF11175_high_26
Description: NF11175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11175_high_26 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 17 - 286
Target Start/End: Complemental strand, 35520828 - 35520559
Alignment:
| Q |
17 |
aattacacctcttgcatacatacattttgggacaatggcttctcttgtaatgattcttagcacaaatcaatgacttcaaaggttgaaacttggcatgttt |
116 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35520828 |
aattacacctcttgcacacatacattttgggacaatgacttctcttgtaatgattcttagcacaaatcaatgacttcaatggttgaaacttggcatgttt |
35520729 |
T |
 |
| Q |
117 |
ttggttccatctacaccctgcttgaggacatgaatatttcctatttttcatactcatcaaataatctctattcttattaattggattgctcaatgctgca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35520728 |
ttggttccatctacaccctgcttgaggacatgaatatttcctatttttcatactcatcaaataatctctattcttattaattggattgctcaatgctgca |
35520629 |
T |
 |
| Q |
217 |
ctactcttgtactcatccccatgagctctcatgtgcatcctcaaatttgcatccctcttgaaccctttgc |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35520628 |
ctactcttgtactcatccccatgagctctcatatgcatcctcaaatttgcatccctcttgaaccctttgc |
35520559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University