View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11175_high_31 (Length: 259)
Name: NF11175_high_31
Description: NF11175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11175_high_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 25 - 253
Target Start/End: Complemental strand, 2926476 - 2926252
Alignment:
| Q |
25 |
aaatatttgatgtgttttgtgtgcgtgtgtggttgatgcagtggtgttggttatgtggcatatcgcgagttttatccatcggaagtggaggcggttaccg |
124 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2926476 |
aaatatttgatgtgttttgtgtg----tgtggttgatgcagtggtgttggttatgtggcatatcgcgagttttatccatcggaagtggaggcggttaccg |
2926381 |
T |
 |
| Q |
125 |
ataggaaaaaagtggtggtgttgggaacaggatgggcggcaacaagttttatgaagaatctggacagtccaaagtatgaagtacaggtggtttcgcctcg |
224 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2926380 |
ataggaaaaaagtggtggtgctgggaacaggatgggcggcaacaagttttatgaagaatctggacagtccaaagtatgaagtacaggtggtttcgcctcg |
2926281 |
T |
 |
| Q |
225 |
taactattttgcattcactcctttgcttc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2926280 |
taactattttgcattcactcctttgcttc |
2926252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University