View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11175_high_32 (Length: 251)
Name: NF11175_high_32
Description: NF11175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11175_high_32 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 9 - 235
Target Start/End: Complemental strand, 1444622 - 1444396
Alignment:
| Q |
9 |
agcagagatgaaagagagaacaaattcagctgagttttgtagaagaatcatgattacatcgcctttctggatgcctaatttggacaaaccagccgcgatt |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1444622 |
agcagcgatgaaagagagaacaaattcagctgagttttgtagaagaatcatgattacatcgcctttctggatgcctaatttggacaaaccagccgcgatt |
1444523 |
T |
 |
| Q |
109 |
ttttggcattggagataggtttcggcataggtatatgtttttccggtggcagcgacgattagacaaggccgatcagcaaattcggagaggttttcgaagc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1444522 |
ttttggcattggagataggtttcggcataggtatatgtttttccggtggcagcgacgattagacaaggccgatcagcaaattcggagaggttttcgaagc |
1444423 |
T |
 |
| Q |
209 |
agtaggtatgaagtgggaggtggttag |
235 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
1444422 |
agtaggtatgaagtgggaggtggttag |
1444396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University