View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11175_high_33 (Length: 248)
Name: NF11175_high_33
Description: NF11175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11175_high_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 40078303 - 40078504
Alignment:
| Q |
1 |
gcaatataatttgtcaaaaaataatatagtgcactaccaagctttatatcatgcaaggagtatatatcatgcattttattgaaaatttcttgttgaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
40078303 |
gcaatataatttgtcaaaaaataatatagtgcactaccaagctttata------------------tcatgcattttattgaaaatttcttgttgaattt |
40078384 |
T |
 |
| Q |
101 |
tgaaaaagataaaagtatattttggtcttcaaaatatgacaacattcgtcaatggtcccccaaattttgatgtattattttgatctttatttttggaact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40078385 |
tgaaaaagataaaagtatattttggtcttcaaaatatgacaacattcgtcaatggtcccccaaattttgatgtattattttgatctttatttttggaact |
40078484 |
T |
 |
| Q |
201 |
atgtcaaatttataagtatt |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40078485 |
atgtcaaatttataagtatt |
40078504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University