View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11175_high_39 (Length: 229)
Name: NF11175_high_39
Description: NF11175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11175_high_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 4 - 224
Target Start/End: Original strand, 34736269 - 34736483
Alignment:
| Q |
4 |
aaaaaataataagaacaatgtacgcaatatatatagttgaaattaggcaaacatgggtggttttgtcattataaaattgaatgaaactcgtgacttgtgg |
103 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34736269 |
aaaaaataataagaacaatggacgcaatatatatagttgaaattaggcaaacatgggtggttttgtcattataaaattgaatgaaactcgtgacttgtgg |
34736368 |
T |
 |
| Q |
104 |
cacggatcaactactatatatgagttgcgtatggctaatttataaagcaacaaattcttcaactatgctatcaacattttcaatttcaatacctagccag |
203 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||| || |
|
|
| T |
34736369 |
cacggatcaactactatatatgagttgtgtatggctaatttataaagcaacaaatttttcaactatgctatcaacat------tttcaatacctagctag |
34736462 |
T |
 |
| Q |
204 |
ttcttatcttctgcccttttt |
224 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
34736463 |
ttcttctcttctgcccttttt |
34736483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University