View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11175_low_14 (Length: 412)
Name: NF11175_low_14
Description: NF11175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11175_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 4e-79; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 4e-79
Query Start/End: Original strand, 2 - 178
Target Start/End: Original strand, 21733157 - 21733338
Alignment:
| Q |
2 |
aaacgaatttataatgaagctttctcttttgatccttttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgcatatta |
101 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21733157 |
aaacgagtttataatgaagctttctcttttgatccttttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgcatatta |
21733256 |
T |
|
| Q |
102 |
ttcttc-----ttttttcatacttaaaacatgcattttaatgcaagtcttaatatattttgatgtaaatcatggatcatttt |
178 |
Q |
| |
|
|||||| ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21733257 |
ttcttcttcttttttttcatacataaaacatacattttaatgcaagtcttaatatattttgatgtaaatcatggatcatttt |
21733338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 3 - 103
Target Start/End: Original strand, 21741659 - 21741759
Alignment:
| Q |
3 |
aacgaatttataatgaagctttctcttttgatccttttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgcatattat |
102 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21741659 |
aacgagtttataatgaagctttctcttttgatccttttctttttgtctctcctcattagctcttctagcagtgagtttcttctcttctattgcatattat |
21741758 |
T |
|
| Q |
103 |
t |
103 |
Q |
| |
|
| |
|
|
| T |
21741759 |
t |
21741759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 329 - 373
Target Start/End: Original strand, 21741810 - 21741854
Alignment:
| Q |
329 |
tttattttctacctatttcaaatttgttgtatgactataatattt |
373 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21741810 |
tttattttctacctatttcaaatttgttgtatgactataatattt |
21741854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 15 - 95
Target Start/End: Original strand, 21748683 - 21748763
Alignment:
| Q |
15 |
atgaagctttctcttttgatccttttctttttgtctctcctaattagctcttctagcagtgagtttcttctcttctattgc |
95 |
Q |
| |
|
|||||||| |||||||||||| |||||||| |||||||||| ||||||| || ||||||||| |||||||||||||||| |
|
|
| T |
21748683 |
atgaagctatctcttttgatcattttctttgtgtctctcctggttagctcatcgtgcagtgagtatcttctcttctattgc |
21748763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 9 - 75
Target Start/End: Complemental strand, 30148119 - 30148053
Alignment:
| Q |
9 |
tttataatgaagctttctcttttgatccttttctttttgtctctcctaattagctcttctagcagtg |
75 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||| | |||||| |||||||||||| || ||||||| |
|
|
| T |
30148119 |
tttataatgaagctttctattttgatcattttctctgtgtctcccctaattagctcatcaagcagtg |
30148053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University