View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11175_low_17 (Length: 387)
Name: NF11175_low_17
Description: NF11175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11175_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 265; Significance: 1e-148; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 101 - 377
Target Start/End: Complemental strand, 13579090 - 13578814
Alignment:
| Q |
101 |
gggtttttcaaacgatgaacaaaaaagtgataaatcatgattaccttgatgaattggagagcggagatttcgaattcaaaacaaaacgtcttttctgttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13579090 |
gggtttttcaaacgatgaacaaaaaagtgttaaatcatgattaccttgatgaattggagagcggagatttcgaattcaaaacaaaacgtctcttctgttt |
13578991 |
T |
 |
| Q |
201 |
agaatctcgatctcgatcaggggtatcttcaacaattagggttgcaagtaacagcgcttcttcatcccaaccagccatagcagcagcagatttgaatctc |
300 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13578990 |
agaatttcgatctcgatcaggggtatcttcaacaattagggttgcaagtaacagcgcttcttcatcccaaccagccatagcagcagcagatttgaatctc |
13578891 |
T |
 |
| Q |
301 |
ggactaataagtgaagccatgttttggctattcgtcgctgttttctttcggatcacggggcttcgtttttgttcatc |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13578890 |
ggactaataagtgaagccatgttttggctattcgtcgctgttttctttcggatcacggggcttcgtttttgttcatc |
13578814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 19 - 52
Target Start/End: Complemental strand, 13579167 - 13579134
Alignment:
| Q |
19 |
aacaaaactaatgaaatcaaccaaattcttcaaa |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
13579167 |
aacaaaactaatgaaatcaaccaaattcttcaaa |
13579134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University