View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11175_low_17 (Length: 387)

Name: NF11175_low_17
Description: NF11175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11175_low_17
NF11175_low_17
[»] chr7 (2 HSPs)
chr7 (101-377)||(13578814-13579090)
chr7 (19-52)||(13579134-13579167)


Alignment Details
Target: chr7 (Bit Score: 265; Significance: 1e-148; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 101 - 377
Target Start/End: Complemental strand, 13579090 - 13578814
Alignment:
101 gggtttttcaaacgatgaacaaaaaagtgataaatcatgattaccttgatgaattggagagcggagatttcgaattcaaaacaaaacgtcttttctgttt 200  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
13579090 gggtttttcaaacgatgaacaaaaaagtgttaaatcatgattaccttgatgaattggagagcggagatttcgaattcaaaacaaaacgtctcttctgttt 13578991  T
201 agaatctcgatctcgatcaggggtatcttcaacaattagggttgcaagtaacagcgcttcttcatcccaaccagccatagcagcagcagatttgaatctc 300  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13578990 agaatttcgatctcgatcaggggtatcttcaacaattagggttgcaagtaacagcgcttcttcatcccaaccagccatagcagcagcagatttgaatctc 13578891  T
301 ggactaataagtgaagccatgttttggctattcgtcgctgttttctttcggatcacggggcttcgtttttgttcatc 377  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13578890 ggactaataagtgaagccatgttttggctattcgtcgctgttttctttcggatcacggggcttcgtttttgttcatc 13578814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 19 - 52
Target Start/End: Complemental strand, 13579167 - 13579134
Alignment:
19 aacaaaactaatgaaatcaaccaaattcttcaaa 52  Q
    ||||||||||||||||||||||||||||||||||    
13579167 aacaaaactaatgaaatcaaccaaattcttcaaa 13579134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University