View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11175_low_19 (Length: 344)
Name: NF11175_low_19
Description: NF11175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11175_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 18 - 295
Target Start/End: Complemental strand, 47492819 - 47492539
Alignment:
| Q |
18 |
atatgtatctattcgaacctaccttttgatggatgcttgggatgctttagtaatgtcttcaaaaaggctaaaagtgagaagagaaaacagtgttggtgtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47492819 |
atatgtatctattcgaacctaccttttgatggatgcttgggatgctttagtaatgtcttcaaaaaggctaaaagtgagaagagaaaacagtgttggtgtg |
47492720 |
T |
|
| Q |
118 |
ataggatgcatggtttgtgttgcatgttggccatcacaaaagtcttgtaagattgattggatttgtttgaatgtttgagacggcttttaaggcgggacct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47492719 |
ataggatgcatggtttgtgttgcatgttggccatcacaaaagtcttgtaagattgattggatttgtttgaatgtttgagacggcttttaaggcgggacct |
47492620 |
T |
|
| Q |
218 |
---accgttctgcttggctttgctgtgttcatgcgtcatgaaacccaacatgtttgttctgctttgaagcaatagatttct |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47492619 |
accaccgttctgcttggctttgctgtgttcatgggtcatgaaacccaacatgtttgttctgctttgaagcaatagatttct |
47492539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University