View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11175_low_34 (Length: 242)
Name: NF11175_low_34
Description: NF11175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11175_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 20 - 232
Target Start/End: Complemental strand, 5159613 - 5159400
Alignment:
| Q |
20 |
ttttctggtttggtttgtggttgtgaaagagctgttgaggataatgtgattagtttggttggtaggtattggctatgtgctttcttcttgttgggtccac |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5159613 |
ttttctggtttggtttgtggttgtgaaagagctgttgaggataatgtgattagtttggttggtagttattggctatgtgctttcttcttgttgggtccac |
5159514 |
T |
|
| Q |
120 |
aaatagccatgctttgcaa-ataaagtttagataagggaaaacataccatggagaattatcagttaaatttgacagattaaacacaggagtacttcttat |
218 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5159513 |
aaatagccatgctttgcaagataaagtttagataagggaaaacataccatggagaattatcagttaaatttgacagattaaacacaggagtacttcttat |
5159414 |
T |
|
| Q |
219 |
gtgtctctgcttct |
232 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
5159413 |
gtgtctctggttct |
5159400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University