View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11175_low_35 (Length: 241)
Name: NF11175_low_35
Description: NF11175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11175_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 34736116 - 34735903
Alignment:
| Q |
1 |
cttcctaatgaaaaaatgtcttctttaatttgcatcgtaagaacgtcttcaatgttacaatttcgagcaattcgctttctaatgaagtgagttttatgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | | ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
34736116 |
cttcctaatgaaaaaatgtcttctttaatttgtgttgcaagaacgtcttcaatgttacaatttcgagcaattcgctttctaataaagtgagttttatgag |
34736017 |
T |
 |
| Q |
101 |
ggatcacacttttaacattttatattttttaggagaatcgaacatgagaatttgaagatgaccatacttcaaaatctcatgtcaatgtcaccaaaccaac |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||| |||||||||||| ||||| |||||||||||||||||||| ||||||| | ||||||| ||||| |
|
|
| T |
34736016 |
ggatcacacttttaacattttatgttttttaagagagtcgaacatgagactttgaggatgaccatacttcaaaatcccatgtcactatcaccaagccaac |
34735917 |
T |
 |
| Q |
201 |
acaagtagatttag |
214 |
Q |
| |
|
|||||| ||||||| |
|
|
| T |
34735916 |
acaagtggatttag |
34735903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University