View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11176_low_14 (Length: 240)
Name: NF11176_low_14
Description: NF11176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11176_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 41275923 - 41275712
Alignment:
| Q |
1 |
ttttggagaacgtgcattaaaatcacttcaacaagagtttcaaagaagtaataattttgtgaatgaagaagtgaatatgttacaaagtgaacttctacat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41275923 |
ttttggagaacgtgcattaaaatcacttcaacaagagtttcaaagaagtgacaattttgtgaat------------atgttacaaagtgaacttctacat |
41275836 |
T |
|
| Q |
101 |
gttaaggaaattatttgctcttccatcaaaggtcttgaagaaatttccaagatgaaatcattcaagtttgttgagaaagagattgnnnnnnngaacatgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41275835 |
gttaaggaaattatttgctcttccatcaaaggtcttgaagaaatttccaagatgaaatcattcaagtttgttgagaaagagattgaaaaaaagaacatgt |
41275736 |
T |
|
| Q |
201 |
ctagtgatgttgaaatgggaaagt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
41275735 |
ctagtgatgttgaaatgggaaagt |
41275712 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University