View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11177_high_6 (Length: 241)
Name: NF11177_high_6
Description: NF11177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11177_high_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 11370774 - 11370551
Alignment:
| Q |
1 |
ataataaattttggaaaacaaacattaagaaaacaagctaaacaataattaagactttacctgcaagagatgaacttcatctatgatgtaattgatttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11370774 |
ataataaattttggaaaacaaacattaacaaaacaagctaaacaacaattaagactttacctgcaagagatgaacttcatctatgatgtaattgatttca |
11370675 |
T |
 |
| Q |
101 |
tttttgaagatagacatagattttaatcttatgtctttgctcatcaacacaattacggatgtaatcacatttaccctagtcaaacaattcctcatctctt |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11370674 |
tttttgaagacagacatagattttaatcttatgtctttgctcatcaacacaattacagatgtaatcacatttgccctagtcaaacaattcctcatctctt |
11370575 |
T |
 |
| Q |
201 |
tacggtcatcttcagataccaagt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
11370574 |
tacggtcatcttcagataccaagt |
11370551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University