View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11178_high_10 (Length: 243)
Name: NF11178_high_10
Description: NF11178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11178_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 89 - 233
Target Start/End: Complemental strand, 31457929 - 31457782
Alignment:
| Q |
89 |
cgcaaaaggaggcggcggt---ggaagcaaagggtccaccggtggcagtggtggtggggattcaatgaaagcaccgggaggtggtggatcatacatatct |
185 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31457929 |
cgcaaaaggaggcggtggtaccggaagcaaagggtccaccggtggcagtggtggtggggattcaatgaaagcacctggaggtggtggatcatacatatct |
31457830 |
T |
 |
| Q |
186 |
cgtggtgcatttgaaaacaaccctcaaggctattttagtggtcttcat |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31457829 |
cgtggtgcatttgaaaacaaccctcaaggctattttagtggtcttcat |
31457782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 91 - 233
Target Start/End: Complemental strand, 49085873 - 49085731
Alignment:
| Q |
91 |
caaaaggaggcggcggtggaagcaaagggtccaccggtggcagtggtggtggggattcaatgaaagcaccgggaggtggtggatcatacatatctcgtgg |
190 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49085873 |
caaaaggaggcggtggtggaagcaaagggtccaccggtggcagtggtggtggagattcaatgaaagcaccgggaggtggtggatcatacatatctcgtgg |
49085774 |
T |
 |
| Q |
191 |
tgcatttgaaaacaaccctcaaggctattttagtggtcttcat |
233 |
Q |
| |
|
||||||||||| |||||| |||||||||||| ||||||||||| |
|
|
| T |
49085773 |
tgcatttgaaagcaacccacaaggctattttggtggtcttcat |
49085731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University