View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11178_high_4 (Length: 313)
Name: NF11178_high_4
Description: NF11178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11178_high_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 4e-72; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 166 - 303
Target Start/End: Original strand, 785795 - 785932
Alignment:
| Q |
166 |
atttgaaatccagcaaaactaagatgatgattgaagatggagggatatttgtgttactggttttgaaatttagtgctacgtaccacaacctttgaaccac |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
785795 |
atttgaaatccagcaaaactaagatgatgattgaagatggagggatatttgtgttactggttttgaaatttagtgctacgtaccacaacctttgaaccac |
785894 |
T |
 |
| Q |
266 |
tctcttcctttactacatttttctactcaatgcctttg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
785895 |
tctcttcctttactacatttttctactcaatgcctttg |
785932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 19 - 101
Target Start/End: Original strand, 785648 - 785730
Alignment:
| Q |
19 |
ggttatgagatagaaactttgttacctatatttaatgaaggaaatcacggtcgaaaacatggttgaagtgggagtgcatccca |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
785648 |
ggttatgagatagaaactttgttacctatatttaatcaaggaaatcacggtcgaaaacatggttgaagtgggagtgcatccca |
785730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 37 - 99
Target Start/End: Complemental strand, 407252 - 407190
Alignment:
| Q |
37 |
ttgttacctatatttaatgaaggaaatcacggtcgaaaacatggttgaagtgggagtgcatcc |
99 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
407252 |
ttgttacctatatttaatcaaggaaatcacggtcgaaaacatggttgaagtgggagtgcatcc |
407190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University