View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11178_low_10 (Length: 249)
Name: NF11178_low_10
Description: NF11178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11178_low_10 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 46 - 249
Target Start/End: Original strand, 5953692 - 5953895
Alignment:
| Q |
46 |
aataaacggataattatattgctatgaaagtgacattttgccctaactaccctttataatgcatgcatgtttgaatgtcgatcagggttagttttggaca |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5953692 |
aataaacggataattatattgctatgaaagtgacattttgccctaactaccctttatactgcatgcatgtttgaatgtcgatcagggttagttttggaca |
5953791 |
T |
 |
| Q |
146 |
ttcacattataaagcacaagttttggtgatagttgctgtagatacggagagatcaagaagtagtgcacgtaacttagaaactatgggaatactttataat |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5953792 |
ttcacattataaagcacaagttttggtgatagttgctgtagatacggagagatcaagaagtagtgcacgtaacttagaaactatgggaatactttataat |
5953891 |
T |
 |
| Q |
246 |
aagc |
249 |
Q |
| |
|
|||| |
|
|
| T |
5953892 |
aagc |
5953895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University