View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11178_low_12 (Length: 221)
Name: NF11178_low_12
Description: NF11178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11178_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 28 - 207
Target Start/End: Complemental strand, 32162404 - 32162225
Alignment:
| Q |
28 |
catttcattggatgaaaaagaaaaagcatgggaagaagggttatgtggggctaaaattggatatggtaaagcatatgatcgcatagaatggagttttcta |
127 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32162404 |
catttcattggatgaaaaagaaaaatcatgggaagaagggttatgtggggctaaaattggatatggtaaagcatatgatcgcatagaatggagttttcta |
32162305 |
T |
|
| Q |
128 |
attgttgtacttgattctatgggattttcgcaaaaatggcaaaatctagttttcaattgtatttcatctgtttctttctc |
207 |
Q |
| |
|
|||| | || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32162304 |
attgctatatttgattctatgggattttcgcaaaaatggcaaaatctagttttcaattgtatttcatctgtttctttctc |
32162225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 28 - 207
Target Start/End: Complemental strand, 26889010 - 26888840
Alignment:
| Q |
28 |
catttcattggatgaaaaagaaaaagcatgggaagaagggttatgtggggctaaaattggatatgg-taaagcatatgatcgcatagaatggagttttct |
126 |
Q |
| |
|
||||||||||||||||||| |||||| |||| ||||| | |||||||||| |||||||||| ||| ||||||||| || ||||||||||| |
|
|
| T |
26889010 |
catttcattggatgaaaaataaaaagaatggcaagaaagattatgtggggataaaattggaaatgtctaaagcata----------gagtggagttttct |
26888921 |
T |
|
| Q |
127 |
aattgttgtacttgattctatgggattttcgcaaaaatggcaaaatctagttttcaattgtatttcatctgtttctttctc |
207 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||| |||||||| |||| || |||||||| | |||||||||||| |
|
|
| T |
26888920 |
aattgttgtacttggttctatgggattttcgcagaaatggtaaaatctaattttaaactgtatttcttttgtttctttctc |
26888840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 30 - 213
Target Start/End: Original strand, 5142373 - 5142557
Alignment:
| Q |
30 |
tttcattggatgaaaaagaaaaagcatgggaagaagggttatgtggggctaaaattggatatggt-aaagcatatgatcgcatagaatggagttttctaa |
128 |
Q |
| |
|
|||||||||||| || ||||||| ||| |||||||| ||||||||| | |||||||| |||| |||||||||||||| || |||||| |||||| | |
|
|
| T |
5142373 |
tttcattggatgtggaaaaaaaagcttggtaagaagggatatgtggggatcaaattggacatggcgaaagcatatgatcgaattgaatgggattttctca |
5142472 |
T |
|
| Q |
129 |
ttgttgtacttgattctatgggattttcgcaaaaatggcaaaatctagttttcaattgtatttcatctgtttctttctctctgct |
213 |
Q |
| |
|
||||| | || | |||||||| ||||| ||||||||||||||||| ||| ||||||||||| || |||||||| ||| |||| |
|
|
| T |
5142473 |
ttgttatcctaaaatctatgggtttttctcaaaaatggcaaaatcttgttcaaaattgtatttcttcggtttctttttctatgct |
5142557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University