View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11179_high_17 (Length: 230)
Name: NF11179_high_17
Description: NF11179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11179_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 218
Target Start/End: Original strand, 50761559 - 50761759
Alignment:
| Q |
18 |
atatgaatccaacaaattaatcaccaatatcccattaagaattgaaaattgaaaaagagggaaaaacaaccttgccattgagccacatacgatcttgttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50761559 |
atatgaatccaacaaattaatcaccaatatcccattaagaattgaaaattgaaaaagagggaaaaacaaccttgccattgagccacatacgatcttgttg |
50761658 |
T |
 |
| Q |
118 |
aaaggaagggctaacagaaacggtagttgtggtgcaaagatgagcgggatcaagcgtgacactgatactatcattaacaggtaagattagggtttcatct |
217 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50761659 |
aaaggaaggactaacagaaacggtagttgtggtgcaaagatgagcgggatcaagagtgacactgatactatcattaacaggtaagattagggtttcatct |
50761758 |
T |
 |
| Q |
218 |
c |
218 |
Q |
| |
|
| |
|
|
| T |
50761759 |
c |
50761759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University