View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11179_high_18 (Length: 219)
Name: NF11179_high_18
Description: NF11179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11179_high_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 379664 - 379865
Alignment:
| Q |
1 |
ttttagccattagattaaacaattnnnnnnntgttcacttagtggaaccttattaaaatagtggttcatcaaactgaggtgtgtcaacaatttggctctt |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
379664 |
ttttagccattagattaaacaattaaaaaaatgttcacttagtggaaccttattaaaatagcgtttcatcaaactgaggtgtgtcaacaatttggctctt |
379763 |
T |
 |
| Q |
101 |
tttcaatatgacttggtatagctcacagttcaacttggtttttcataaaccgtgaacatacctaattgcaggttatcactgcactttctagttgtcatat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
379764 |
tttcaatatgacttggtatagctcacagttcaacttggtttttcataaaccgtgaacatacctaattgcaggttatcactgcactatctagttgtcatat |
379863 |
T |
 |
| Q |
201 |
cc |
202 |
Q |
| |
|
|| |
|
|
| T |
379864 |
cc |
379865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University