View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11179_high_7 (Length: 363)
Name: NF11179_high_7
Description: NF11179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11179_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 102 - 348
Target Start/End: Complemental strand, 2138250 - 2137998
Alignment:
| Q |
102 |
atgtggtgattttgggctatagtaatattccaatggtgaaactggtgaagccataacaacacttcgcatgttgtt------gttgttgttttggaacatc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2138250 |
atgtggtgattttgggctatagtaatattccaatggtgaaactggtgaagccataacaacacttcgcatgttgttattgttgttgttgttttggaacatc |
2138151 |
T |
 |
| Q |
196 |
atgggattttccgacacgttgagttggagttttttagaacggcgttcgtggagtttgaagttgggnnnnnnnaagcccattggtggttccatggtggttg |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2138150 |
atgggattttccgacacgttgagttggagttttttagaacggcgttcgtggagtttgaagttgggtttttttaagcccattggtggttccatggtggttg |
2138051 |
T |
 |
| Q |
296 |
ttggtagaggacggtgggcttgggcttgggcttgggctgttagacgagatggg |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2138050 |
ttggtagaggacggtgggcttgggcttgggcttgggctgttagacgagatggg |
2137998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 2138351 - 2138294
Alignment:
| Q |
1 |
ggtaaaagtgcaggtggttgttgctgagaagctctaggagaggggtgcaaatagaaac |
58 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2138351 |
ggtaaaagtgcaggtggttgttgctgagaagctctaggagaggggtgcaaatagaaac |
2138294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University