View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11179_low_22 (Length: 219)

Name: NF11179_low_22
Description: NF11179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11179_low_22
NF11179_low_22
[»] chr7 (1 HSPs)
chr7 (1-202)||(379664-379865)


Alignment Details
Target: chr7 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 202
Target Start/End: Original strand, 379664 - 379865
Alignment:
1 ttttagccattagattaaacaattnnnnnnntgttcacttagtggaaccttattaaaatagtggttcatcaaactgaggtgtgtcaacaatttggctctt 100  Q
    ||||||||||||||||||||||||       |||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||    
379664 ttttagccattagattaaacaattaaaaaaatgttcacttagtggaaccttattaaaatagcgtttcatcaaactgaggtgtgtcaacaatttggctctt 379763  T
101 tttcaatatgacttggtatagctcacagttcaacttggtttttcataaaccgtgaacatacctaattgcaggttatcactgcactttctagttgtcatat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
379764 tttcaatatgacttggtatagctcacagttcaacttggtttttcataaaccgtgaacatacctaattgcaggttatcactgcactatctagttgtcatat 379863  T
201 cc 202  Q
    ||    
379864 cc 379865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University