View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11179_low_23 (Length: 211)
Name: NF11179_low_23
Description: NF11179
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11179_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 14 - 195
Target Start/End: Original strand, 29622139 - 29622320
Alignment:
| Q |
14 |
cacagacactcacccatcacatttgtacttattatttccatctaaaacctcaggctgaaaaaacttttgcatagaatccctaattgaattactatgaaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29622139 |
cacagacactcacccatcacatttgtacttattatttccatctaaaacctcaggctgaaaaaacttttgcatagaatccctaatcgaattactatgaaaa |
29622238 |
T |
|
| Q |
114 |
acatcgagattaatatccataatctcatcaaccttattcgattcgtatccgcaagataaacacttaacctgactctgcaaag |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29622239 |
acatcgagattaatatccataatctcatcaaccttattcgattcgtatccgcaagataaacacttaacctgactctgcaaag |
29622320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University