View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1117_high_2 (Length: 267)
Name: NF1117_high_2
Description: NF1117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1117_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 29 - 222
Target Start/End: Original strand, 4821849 - 4822046
Alignment:
| Q |
29 |
aatatatatacatgttacatgtagtttagcttttcaatccgttctaaacttctaatacgtaaaattcacatgggaggaaaatggtttcttctccatccat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4821849 |
aatatatatacatgttacatgtagtttagcttttcaatccgttctaaacttctaatacgtaaaattcacatgggaggaaaatggtttcttctccatccat |
4821948 |
T |
|
| Q |
129 |
actttatat----tataatcgtgtaaagaacaagaaatcacaaggaggatgctaatgaataaccacctgaggtcttcctccgccgtttgccggaaaat |
222 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4821949 |
actttatattatatataatcgtgtaaagaacaagaaatcacaaggaggatgctaatgaataaccacctgaggtcttcctccgccgtttgccggaaaat |
4822046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University