View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1117_low_1 (Length: 522)
Name: NF1117_low_1
Description: NF1117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1117_low_1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 2e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 2e-78
Query Start/End: Original strand, 318 - 513
Target Start/End: Original strand, 14758536 - 14758721
Alignment:
| Q |
318 |
aagaaagtagagaaccattttgcttgactttctcgtttgctcttgtttcttcctttcccctacgcatgtgtagtggtttttggttgtctttggttgtttc |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||| |
|
|
| T |
14758536 |
aagaaagtagagaaccattttgcttgactttctcgtttgctcttgtttcttcctttcccctaagcatgtgtggtggtttttg----------gttgtttc |
14758625 |
T |
|
| Q |
418 |
tttcagtactggaccatccatcttttttgatgaaaaatatagcccgtgttttaaagcgaaaatattaatttatactagtaatttgttttttctttt |
513 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
14758626 |
tttcagtactggaccatccatcttttttgatgaaaaatatagcccgtgttttaaagcgaaaatgttaatttatactagtaatttgttttttctttt |
14758721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 89 - 160
Target Start/End: Original strand, 3614430 - 3614504
Alignment:
| Q |
89 |
atgagttttcatagtgtgaagagggaacatggaggag---taattaatttatggaccaataagtggaatagggac |
160 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| || ||||||||| |||||||| |||||||||| |||| |
|
|
| T |
3614430 |
atgagttttcatagtgtgaagagggaatatggagaagtaataattaattggtggaccaagaagtggaatatggac |
3614504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 314 - 370
Target Start/End: Original strand, 3614739 - 3614793
Alignment:
| Q |
314 |
gatgaagaaagtagagaaccattttgcttgactttctcgtttgctcttgtttcttcc |
370 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||| |||||||||||||||||||||| |
|
|
| T |
3614739 |
gatgaagaaagtagaaaactatta--cttgacttgctcgtttgctcttgtttcttcc |
3614793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University