View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1117_low_7 (Length: 314)
Name: NF1117_low_7
Description: NF1117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1117_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 82 - 217
Target Start/End: Original strand, 22794898 - 22795036
Alignment:
| Q |
82 |
gagatgaaaatccgagagtactttgccttcatttcgacgcaaatcacattctggag---gaggagatactcattttaattcaatgcatcccatcactgag |
178 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22794898 |
gagaagaaaatccgagagtactttgccttcatttcgacgcaaatcacattctggaggaggaggagatactcattttaattcaatgcatcccatcactgag |
22794997 |
T |
|
| Q |
179 |
acccctgaaaataaaatcaactcgcgtcgccgttctttc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22794998 |
acccctgaaaataaaatcaactcgcgtcgccgttctttc |
22795036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University