View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_high_10 (Length: 339)
Name: NF11180A_high_10
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 9 - 337
Target Start/End: Original strand, 48290558 - 48290886
Alignment:
| Q |
9 |
gagatgaatgagctaacgttgatgaaagcaaatacagtggttgatgttatcaattaaatgaaatgaaatgccctaaaagtttagacattatcaaccaaaa |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48290558 |
gagatgaatgagctaacgttgatgaaagcaattacagtggttgatgttatcaattaaatgaaatgaaatgccctaaaagtttagacattatcaaccaaaa |
48290657 |
T |
 |
| Q |
109 |
aaggcagtagtgttggctaattgtgatttttgcaagctaagctataatcaatttactattaattataactagattaaagatgctacatctctttcttcat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48290658 |
aaggcagtagtgttggctaattgtgatttttgcaagctaagctataatcaatttactattaattataactagattaaagatgctacatctctttcttcat |
48290757 |
T |
 |
| Q |
209 |
gtccctttccatttacaccactcattgcaagctttgaacgcttcttatatttcttattatcaacatctacctctttaattttctgttttctcaaaccttc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48290758 |
gtccctttccatttacaccactcattgcaagctttgaacgcttcttatatttcttattatcaacatctacctctttaattttctgttttctcaaaccttc |
48290857 |
T |
 |
| Q |
309 |
ttcacatttaattaatttcatcaattttg |
337 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48290858 |
ttcacatttaattaatttcatcaattttg |
48290886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University