View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_high_14 (Length: 329)
Name: NF11180A_high_14
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_high_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 15 - 324
Target Start/End: Complemental strand, 402621 - 402312
Alignment:
| Q |
15 |
atgaatggtcctcttcgtttgcagaacctggtaccagaattagaagtgccagctaattatgaccaaggcgttgtacattacttacaaagttaactatttt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
402621 |
atgaatggtcctcttcgtttgcagaacctggtaccagaattagaagtgccagctaattatgacgaaggcgttgtacattacttacaaagttaactatttt |
402522 |
T |
|
| Q |
115 |
gttttactgtctgcattacttgcaaattaactaaaactctaacggttggaagagtgatttgattagtgtcacttgatnnnnnnnnnnnnnnnnnnnnntg |
214 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
402521 |
gttttactgtctacattacttgcaaattaactaaaactctaacggttggaagagtgatttgattagtgtcacttgataaaaacaagaaaaaatgaaaatg |
402422 |
T |
|
| Q |
215 |
agtattttaagacgcgcatattcgtcttctcttgattttgtcaaaactgatatcaatcaagtcatcgtctcaactctcaaccaaggttaggagaaccatg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
402421 |
agtattttaagacgcgcatattcgtcttctcttgattttgtcaaaactgatatcaatcaagtcatcgtctcaactctcaaccaaggttaggagaaccatg |
402322 |
T |
|
| Q |
315 |
aatttttatt |
324 |
Q |
| |
|
||||||||| |
|
|
| T |
402321 |
tatttttatt |
402312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University