View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_107 (Length: 266)
Name: NF11180A_low_107
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_107 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 14 - 266
Target Start/End: Complemental strand, 4083157 - 4082905
Alignment:
| Q |
14 |
gaatattgtagcgtttgttgtgtttttgtccgtggttgtggcttctttggtgtttgatatcggtgttgtagggggcggcgtcaattttcttcttcgaaat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4083157 |
gaatattgtagcgtttgttgtgtttttgtccgtggttgtggcttctttggtgtttgatatcggtgttgtagggggcggcgtcaattttcttcttcgaaat |
4083058 |
T |
|
| Q |
114 |
cgaacactacatagagttgtgattatggcaatgcttgttgctaatcctattagggagaatgaaaaatatagaaatggacctatcaattaattattggcat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||| ||||||| |
|
|
| T |
4083057 |
cgaacactacatagagttgtgattatggcaatgcttgttgctaatcctattagggagaatgaaaaatttagaaatggacctattaataaattgttggcat |
4082958 |
T |
|
| Q |
214 |
tgtcatagggcatacgtcttcccatgacaaaagctattatctatgtatgtgat |
266 |
Q |
| |
|
|||||||||||| | ||||||||||||||||| ||||||| ||||| ||||| |
|
|
| T |
4082957 |
tgtcatagggcaatcttcttcccatgacaaaagatattatcgatgtaagtgat |
4082905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 103 - 146
Target Start/End: Original strand, 48203029 - 48203072
Alignment:
| Q |
103 |
ttcttcgaaatcgaacactacatagagttgtgattatggcaatg |
146 |
Q |
| |
|
||||||| ||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
48203029 |
ttcttcggaatcgaaaactacatatagttgtgattatggcaatg |
48203072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University