View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11180A_low_108 (Length: 265)
Name: NF11180A_low_108
Description: NF11180A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11180A_low_108 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 10 - 259
Target Start/End: Complemental strand, 43541113 - 43540864
Alignment:
| Q |
10 |
cacagaattaataatataataacattatccagctagcatgtcttgaatcttgatcaaacaaaattttcccctttaacatgacattttattccnnnnnnnt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43541113 |
cacagaattaataatataataacattatccagctagcatgtcttgaatcttgatcaaacagaattttcccctttaacatgacattttattccaaaaaaaa |
43541014 |
T |
 |
| Q |
110 |
taaatagtcttctacaatcttaatatcctaagtttacatatgacattgtggtttgcaagctaaatctacttcctcataactgaaagttaatttttggttt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43541013 |
taaatagtcttctacaatcttaatatcctaagtttacatatgatattgtggtttgcaagctatatctacttccacataactgaaagttaatttttggttt |
43540914 |
T |
 |
| Q |
210 |
caaaagcttctctcgttcaacaaattaatcagcttgctccatggacaatt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540913 |
caaaagcttctctcgttcaacaaattaatcagcttgctccatggacaatt |
43540864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University